Martin Krzywinski / Canada's Michael Smith Genome Sciences Centre / mkweb.bcgsc.ca Martin Krzywinski / Canada's Michael Smith Genome Sciences Centre / mkweb.bcgsc.ca - contact me Martin Krzywinski / Canada's Michael Smith Genome Sciences Centre / mkweb.bcgsc.ca on Twitter Martin Krzywinski / Canada's Michael Smith Genome Sciences Centre / mkweb.bcgsc.ca - Lumondo Photography Martin Krzywinski / Canada's Michael Smith Genome Sciences Centre / mkweb.bcgsc.ca - Pi Art Martin Krzywinski / Canada's Michael Smith Genome Sciences Centre / mkweb.bcgsc.ca - Hilbertonians - Creatures on the Hilbert CurveMartin Krzywinski / Canada's Michael Smith Genome Sciences Centre / mkweb.bcgsc.ca - Pi Day 2020 - Piku
Feel the vibe, feel the terror, feel the painHooverphonicMad about you, orchestrally.more quotes

sequencing: deep


Scientific graphical abstracts — design guidelines


data visualization + art + finding your way

Martin Krzywinski @MKrzywinski mkweb.bcgsc.ca
As the night comes on, the signs reveal the mystery of the cell.
Solve the puzzle.
Martin Krzywinski @MKrzywinski mkweb.bcgsc.ca
Enjoy the sign as posters and 4k desktops.
Or, try your own design—download the font and the data.

DNA on 10th — Science this way

The signs encode the sequence in the following way

Cambie Health Corridor Wayfinding Signs - Genome Art by Martin KRzywinski / Martin Krzywinski @MKrzywinski mkweb.bcgsc.ca
How DNA sequence is encoded on the signs. Complementary bases (A/T) and (C/G) are mirror images of each other. Repeats are shown with a small circle (base repeats twice) or a large circle (base repeats three times). Longer repeats are shown by combinations of these shapes, as shown by the example ATTCGGGGGT sequence on the right.

To understand the contents shown below, see Design & Methods.

The length of row sequences varies because a single symbol can encode 1 (e.g. A), 2 (e.g. AA) or 3 bases (e.g. AAA).

south sign

row gene     mutation helix dir  code                        N    sequence            
 92 KRTAP2     C>T      5      GTCGACGACGACXCGTGT 2105 GTCCGGGACGACGACC/TCGGTGGT
 91 MRPS10     G>C      3      AAXTGATGTGCACTACAG 2082 AAAAG/CTTTGGATGTGCAACTACAAG
 90 BRCA1      A>G      5      TCTCGACACAXTCTGTCG 2057 TCTTCGACACAA/GTCTTGTCG
 89 NEGR1      G>A      3      CTGXTCGACCTATACTAC 2037 CCCTGG/ATCCGACCCCTTATACTTAC
 88 CACNA1G    C>T      5      CGACACGAXCGTAGACAC 2012 CGACACGAC/TCCGTAGGACAC
 87 CKAP2      C>T      3      CACAGXGTAGAGAGTATC 1992 CACAGC/TGTAGAGAAGTTATCC
 86 MYO9A      G>A      5      CGCGTCXCTCACACTCTA 1971 CGCGTTCG/ACTTCACACTTCTAA
 85 ADSSL1     A>G      3      AGGTGTXCGCTGCGTGCG 1949 AGGGGTGGTA/GCGGCTGCGGTGCG
 84 RAF1       T>C      5      TACTXATGACTACGACGC 1926 TAACCTT/CATGACTACGACGC
 83 GCNT3      C>T      3      GTGTCGAGXGTCATCGAG 1906 GTGTCGAGC/TGTCATCGGAAAG
 82 OR2M7      C>A      5      ATAXTCTCATAAGTAGAC 1885 ATAAAC/ATTCTCCAATAAAAGTAGAC
 81 ROCK1      G>A      3      CTCGATGTCTAXTCGACT 1860 CCCTCGATGTTCTAG/ATCGAACTT
 80 TP53       C>T      5      CAXATGTCAGACGTACGC 1837 CAC/TATTGTCAAGGACGTACCCGC
 79 PCDHA2     C>T      3      GACGTACTATAGXAGACG 1814 GACGTTACTAATAAGC/TAAAGAACG
 78 SHTN1      C>A      5      AXTCTCTATGTACTACTA 1790 AC/ATTCTCTATTTGTAACTACTA
 77 CENPE      G>A      3      TACTAGATTGTGAGXTCT 1768 TACTAGATTTTGTTGAGG/ATTCTTT
 76 IFI44      C>T      5      AXCTTGTCTGAGTGACTC 1744 AAC/TCTTTTGTCTGGAGTGACTC
 75 MMP17      C>A      3      CTGCGCGTGACAGAGXAT 1722 CTGCGCGTGGAACAGGAGC/AAT
 74 OR4D6      C>T      5      GAXTAGAGTCTATCTACT 1701 GAAC/TTAAAGAGTCCCTTATCTACT
 73 NRAS       T>C      3      ATGACTATGTCGACTGXT 1677 ATGACCTATGTCGACCTGT/CT
 72 HNRNPAB    C>G      5      AGAXTGCAGTCACACTAG 1657 AGAAC/GTGGCAGGTCACAACCCTAGG
 71 EXTL1      G>A      3      GTCGTCTGTCGTCTCGXT 1632 GGTCGTCCTGTTCGTCCTCGG/AT
 70 GSE1       G>T      5      GAGAXAGCGTCGTAGAGC 1610 GAGAG/TAGCGTCGTAGGAGGC
 69 KRAS       T>G      3      GAGCTGTGTCGTCAGTXC 1590 GAGCTGTGTCGTCCAGTT/GC
 68 ZNF43      G>C      5      TGTAGAXTGATGATGTGT 1571 TGGGTTAGGAG/CTTTGGAATGATGTGT
 67 OLR1       C>T      3      GTCAGATGAGAGTACXAC 1545 GTCAAAGAAATGAGAGGTACC/TACC
 66 CYP7B1     G>A      5      TGACACACXCTCTCTGAC 1521 TGACACACG/ACTTTCCCTCTGAACC
 65 NF2        C>T      3      GAGACGACGAGAGXGAGC 1497 GAAGACGAACCGAGAAGC/TGAGGC
 64 OBSCN      G>A      5      AGCAGACATGXTGTATGA 1474 AAGGGCAGGAACATGG/ATGTATTGGA
 63 LIPC       C>T      3      ACTCCTGACGAGXGCATG 1449 AAACTTCCCCCTGACCCGAGC/TGCAATG
 62 TP53       G>A      5      GTACACATGTCAXGACGT 1422 GTACACATTGTCAAG/AGACGT
 61 POLE       T>C      3      CTCTAGAGCAXTGACAGA 1402 CTTCTAGAGCAT/CTGACAGGA
 60 ADSSL1     A>G      5      TGTCGAGAGGTGTXCGCT 1382 TGTCGAGGAGGGGTGGTA/GCGGCT
 59 NKX2       C>T      3      ACAGAGACXTGACACTCG 1359 ACCAGAGGACC/TTTGACCACTCCGG
 58 OPRM1      G>A      5      GACTACTATCGAGTAXTA 1335 GACTACCTAAATCGGGAGTAG/ATA
 57 SYT1       G>A      3      CAGTGCXGTAGAGTCATG 1312 CCAGTGCG/AGTAAGGAGTCAATG
 56 TP53       C>T      5      ATGTACACATGTCAGAXG 1290 ATGTACACATTGTCAAGGAC/TG
 55 RAF1       T>C      3      TACTXATGACTACGACGC 1269 TAACCTT/CATGACTACGACGC
 54 EFCAB2     A>G      5      CTAGTGCGTGACGTGAXG 1249 CTAGTGCGGTGACGTGAA/GG
 53 PTPN6      C>A      3      GAGXGTGTACTGACTACA 1230 GGAGC/AGTGTACTGGAACTACA
 52 EVPLL      G>T      5      GAGTCGACGACGCAGAXG 1209 GAAGTCCGACGACGGGCAGAG/TG
 51 RASGRF2    G>T      3      GAXGACGCACTCACGATG 1187 GAG/TGACCGCACTCCCACGATTG
 50 TRAV9      T>A      5      TCTATGATCGACTCTXAT 1165 TCTATGATTCGGACCTCTT/AAT
 49 EZH2       A>G      3      TXTGACACTCTCATCGTG 1144 TTA/GTGACACCTCTCCATTCCGTG
 48 NXPE2      A>C      5      GATGCACTCGACTCXGTC 1121 GATGCACCCTCCGACTCA/CGTCC
 47 KRAS       C>G      3      AXCACGCATCGTCTCACG 1099 AC/GCACCGCATCCGTTCTCACGG
 46 ERBB2      T>C      5      TCGATGAGTCTCXGACTC 1077 TCGATGAGTCCTCT/CGACTCC
 45 CTNNB1     A>G      3      ACXTCACGTGTCTACTAG 1057 ACCA/GTCACCGTGGTCTTACCTAAG
 44 SNRPN      T>C      5      TGAGTATACGAXTGTGAG 1033 TGAGGTTATACCGAAAT/CTGGTGGAG
 43 ERBB2      T>C      3      CTCXGACTCGTCTCTACG 1008 CCTCT/CGACTCCGTCCTCTTAACG
 42 CMYA5      C>G      5      AGAGTACGTXATGACTAC  985 AGGAGGTACGTC/GATTTGGACTTTAC
 41 NCF2       C>A      3      TGACXTCAGTCTCCTATA  960 TGGACC/ATCAAAGTCCTTCCCCTATA
 40 TP53       C>T      5      ACGTACGXCGTACTGCTC  935 ACGTACCCGC/TCGTACTTGGCCTCC
 39 EPAS1      G>T      3      CACAGAXGTCAGTCGAGT  911 CACAGAG/TGTTCAGGTCGAGT
 38 TP53       C>A      5      TACGCXGTACTGCTCGTA  891 TACCCGCC/AGTACTTGGCCTCCGGGTA
 37 IGHV2      G>C      3      TACTATATXATGTCGTGT  865 TACTATTTATG/CATGTCGTGT
 36 CTNNB1     A>G      5      CACXTCACGTGTCTACTA  845 CACCA/GTCACCGTGGTCTTACCTAA
 35 SAV1       G>A      3      TCTGAGACAGXCTATATA  821 TCTGAGACCAAGGG/ACTATAATAA
 34 EP300      C>T      5      CTXTGTGACTCGACTGCG  798 CTC/TTGTGACCTCGAACTGGCG
 33 MOCOS      C>T      3      AGCTCGACGAGAXCTCTG  777 AAAGCTCGACCGAGAC/TCCTCTTG
 32 OR5H6      G>A      5      AXGTCTACTCTGTATCTG  754 AAAG/AGTCTACTCTTGTTAATCTGG
 31 ZNF589     C>G      3      TCATACTGAGACGAXTAG  730 TCCATACCTGAAGACCGAAAC/GTAAG
 30 KLRG1      T>C      5      GXTCAGACTGAGATGTGT  705 GT/CTTCAGACTGGAAGAATGTGT
 29 NDEL1      G>A      3      GTAGACTCGCTCGCGXCT  683 GTAGACTCGCTCGGGCGG/ACT
 28 EVPLL      G>T      5      AXGACGACACGACGTCGA  663 AG/TGACGACCACGACGTCCCGGA
 27 GNA13      G>A      3      CTCACGCTCGCTCGTCXT  641 CTCACCGCTCCGGCTCGTCG/ATT
 26 HSPG2      C>T      5      CAXCGACTCATAGCGACA  619 CAC/TCGGGACCTCATAGCGACA
 25 TRABD      G>C      3      TCGCGCCTCGTCAGAGXA  598 TCGCCCGCCCCTCGTCAGAGG/CA
 24 B2M        A>G      5      CTGAXTGGTGATGATAGA  576 CTGAA/GTGGGGTGAATTGATAGAA
 23 ITIH1      C>T      3      CTGAGTGCGCAGTGAGXC  553 CCTGAGTGGCGGCCAGTGAGC/TC
 22 TP53       G>A      5      TACTGXCTCGTAGAGTGT  531 TACTTGG/ACCTCCGGGTAGGAGTGGT
 21 MARC2      G>A      3      CGCTCTCGACTCGCGXTA  506 CGCCTCCTCGACCTTCGCGGG/ATA
 20 TP53       C>T      5      CGTACTGXCTCGTAGAGT  483 CCGTACTTGGC/TCTCCGGGTAGGAGT
 19 PIK3CA     A>G      3      CACAGTCGTGTACTXCAC  458 CAACAGGTCGGTGGTACTA/GCAC
 18 SNRPN      T>C      5      AGTATACGAXTGTGAGAC  436 AGGTTATACCGAAAT/CTGGTGGAGAACC
 17 LRRC34     C>A      3      AGTCTCACTACTXTATTC  409 AGGTTCTTCACCTACTTC/ATTTAATTTTTC
 16 EP300      C>T      5      CGTAGCTGTGAXCGTCGT  380 CCGTAAGGCTGTGAC/TCGTTCGT
 15 ADSSL1     A>G      3      CGAGAGGTGTXCGCTGCG  358 CGAGGAGGGGTGGTA/GCGGCTGCGG
 14 HRNR       G>C      5      ACAGACAGTCGATXAGAG  334 ACAGACCAAGTCCGATG/CAGAAG
 13 CDKN2B     C>T      3      GCCGTGCGXTGCACGTCA  312 GCCCCGGTGGCGC/TTGCAACGTCCCA
 12 TP53       C>A      5      TACGCGTACTGCTCXGTA  287 TACCCGCCGTACTTGGCCTCC/AGGGTA
 11 IGHV2      G>C      3      CTATATXATGTCGTGTAG  261 CTATTTATG/CATGTCGTGTAG
 10 EZH2       T>G      5      TACTAGTAGAGTCTAXGA  241 TTTACTTAAGTAGAGTCTTAT/GGA
  9 MRPS10     G>C      3      TCAAXTGATGTGCACTAC  218 TCAAAAG/CTTTGGATGTGCAACTAC
  8 CTNNB1     A>G      5      GAGTCTCTCTCGACACXT  194 GAGTCTCTTCCTCGACACCA/GT
  7 RAF1       T>C      3      ACTXATGACTACGACGCA  173 AACCTT/CATGACTACGACGCA
  6 EFCAB2     A>G      5      CTAGTGCGTGACGTGAXG  153 CTAGTGCGGTGACGTGAA/GG
  5 C20ORF96   C>A      3      TCXTCACTGAGACTCGTG  134 TCC/ATTCACTTGAAGGACTCGTG
  4 NRAS       G>T      5      ATGACTATGTCGACTXTC  112 ATGACCTATGTCGACCTG/TTTC
  3 APC        C>T      3      AXCGTGTCACGAGAGTAC   91 AAC/TCCGGTGTTCACGAGAGTAC
  2 CHD4       G>A      5      AGTCTATAGATCGAXCTC   69 AGTTCTTATTTAAAGATCGAG/ACTTCC
  1 CDKN2A     T>C      3      TXGACGCGCTGGCGTGAG   43 TT/CGACGCGGCTGGGGCGGTGAG
  0 BRCA1      A>G      5      TGATCTCGACACAXTCTG   21 TTGATCTTCGACACAA/GTCTTG

north sign

row gene     mutation helix dir  code                        N    sequence            
 92 KMT2D      C>T      5      GTGTGXTGCTGCTGCTGC 2098 GTTGTTGC/TTGCTGCTGCTGC
 91 MRPS10     G>C      3      GACATCACGTGTAGTXAA 2078 GAACATCAACGTGTAGGTTTG/CAAAA
 90 B2M        A>G      5      TAGTGGTXAGTCTACATC 2053 TTAAGTGGGGTA/GAGTCTTACATTC
 89 NEK10      T>A      3      ACACTATATCAGCTXGAT 2029 ACCACTAATAAATTCAGCTT/AGGAT
 88 CTNNB1     G>T      5      AGTCTACTGXACTCTGAT 2005 AGTCTTACCTGG/TACTCTGGAAT
 87 CD84       C>T      3      AGCAGAGCAGATXCATAG 1983 AGGCAAAGGAGCAAGATC/TCATAGG
 86 MALRD1     C>A      5      TGATGATCTGTXATATGA 1959 TTGATGATCTGTC/AATTTATGGA
 85 ADSSL1     A>G      3      GCGTGCGTCGCXTGTGGA 1937 GCGTGGCGTCGGCA/GTGGTGGGGA
 84 RAF1       T>C      5      CGCAGCATCAGTAXTCAT 1914 CGCAGCATCAGTAT/CTCCAAT
 83 GRK5       G>T      3      TTATGCGCAXAGATCTCT 1894 TTTTATGCGGCAG/TAGATCCTCT
 82 OPRM1      G>A      5      TGTCTCTGTAGAATXATG 1872 TGTCTTCCTGTAAAGAAAATG/AATG
 81 RASA3      G>A      3      AGTCTCXGAGATGTGTGG 1848 AGTTTCCTCG/AGAAGATGGTGTTGGGG
 80 TP53       C>T      5      CGCATGCAGACTGTAXAC 1822 CGCCCATGCAGGAACTGTTAC/TAC
 79 PIM1       C>T      3      GCGTGXAGATCTCTCGAC 1799 GCCGGTGC/TAAGATCTCTTCGAC
 78 SYNDIG1    G>A      5      AGCGTGCTGCGCTCTGXG 1777 AGGGCGTGCTGCGCTCCTGG/AGGG
 77 CELF2      G>A      3      CTCXTCTGCAGCAGCCAC 1754 CCTCG/ATCTGGCAGCAAGGCCCCAC
 76 IFI44      C>T      5      CTCAGTGAGTCTGTTCXA 1730 CTCAGTGAGGTCTGTTTTCC/TAA
 75 MKI67      G>A      3      CTXATGTCATCTCTGGAG 1708 CTG/AAATGTCCATCTCTGGGGAGG
 74 OR4K1      C>T      5      ATCATTGATCGTGTCXGA 1685 ATCATTTTGATCGGTGTCC/TGA
 73 NXPE2      A>C      3      GXCTCAGCTCACGTAGCT 1664 GA/CCTCAGCCTCCCACGTAGCT
 72 ST7        A>G      5      CTGCTACTGCTCATXTGA 1643 CCTGCTTACTGCTTCATTA/GTGGA
 71 ERBB2      G>A      3      CXCTCACTGCTGAGACGA 1620 CCG/ACTCACTGCTGGAGGACGA
 70 GJE1       C>T      5      CTTCTGATCGATCXGATA 1599 CCCTTTTCTTTGGATCGATCC/TGAATA
 69 KRAS       T>G      3      CXTGACTGCTGTGTCGAG 1573 CT/GTGACCTGCTGTGTCGAG
 68 TRIM46     T>C      5      CTCGAGCTGAGXAGAGAT 1554 CTCGGGAGGCTGAGGT/CAGGAGAAT
 67 OR5H6      G>T      3      TGXAGTCTCTATTACACT 1530 TGG/TAGTCTCTATTTTACACT
 66 CCDC154    G>A      5      TGCAGCTCTXCGCAGCCA 1510 TGGCCAGCTCCTG/ACCGCAGGGCCCCAA
 65 NWD2       C>T      3      GCTCXAGAGACGCATGAG 1483 GCTCC/TAGAAGACCCGCATGAAG
 64 ORMDL3     G>A      5      CGCTGCTXGTCGGTCTCA 1461 CGCCTTGCCCTG/AGTCCGGGGTCTCAAA
 63 LMTK3      G>T      3      GCAGCXAGAGCGAGAGCT 1434 GCCAGCG/TAGAGCCGGGAGAGCCT
 62 TP53       G>A      5      TGCAGXACTGTACACATG 1411 TGCAGG/AAACTGTTACACATG
 61 POLE       T>C      3      CTGTAGCXTCAGTCTCTG 1391 CTGTAGCCCT/CTCCAGTTCCTTCCTG
 60 ADSSL1     A>G      5      TCGCXTGTGGAGAGCTGT 1366 TCGGCA/GTGGTGGGGAGGAGCTGT
 59 NF1        C>T      3      CTGCTGAGCXTCACAGAC 1343 CTGCTGAAAGCC/TTTCACAAGACC
 58 OR2M7      C>A      5      CTXATATGATGTGTCATG 1320 CTTC/AAAATATTGATGTGTCATTG
 57 SLC25A24   G>A      3      CTGATATCGTCXAGAGCA 1297 CTTTGGAAATAATTCGTCG/AAAAGAGGCCAA
 56 TP53       C>T      5      GXAGACTGTACACATGTA 1267 GC/TAGGAACTGTTACACATGTA
 55 RAF1       T>C      3      CGCAGCATCAGTAXTCAT 1246 CGCAGCATCAGTAT/CTCCAAT
 54 EFCAB2     A>G      5      GXAGTGCAGTGCGTGATC 1226 GA/GAGTGCAGTGGCGTGATC
 53 PIK3CA     G>A      3      GTGATGTATATCGAXACA 1207 GTGAATGTAAATATTCGAG/AACA
 52 EPAS1      G>T      5      GXAGACACTGCACTATAT 1185 GG/TAGACACTGGCACCCTATAT
 51 RNF40      C>T      3      CAGACTCTCAGTCTCXGA 1164 CAGAACTCCTCAAGGGTCTCC/TGA
 50 TPO        C>A      5      TGXGCGACCTACGAGTAG 1141 TGC/AGCGGACCCCTACGAGTTAGG
 49 LINC00207  A>G      3      TCTGCTGCTGCATCTGXA 1118 TCCTGCTGCTGCATCTTGA/GA
 48 NRAS       T>C      5      TCTXGTCAGCTGTATCAG 1098 TTCTT/CGTCCAGCTGTATCCAG
 47 KRAS       C>G      3      AGCACTCTGCTACGCAXC 1077 AGGCACTCTTGCCTACGCCAC/GC
 46 ERBB2      T>C      5      CTCAGXCTCTGAGTAGCT 1055 CCTCAGT/CCTCCTGAGTAGCT
 45 CTNNB1     A>G      3      GATCATCTGTGCACTXCA 1035 GAATCCATTCTGGTGCCACTA/GCCA
 44 SNRPN      T>C      5      GAGTGTXAGCATATGAGT 1011 GAGGTGGTT/CAAAGCCATATTGGAGT
 43 ERBB2      T>C      3      GCATCTCTGCTCAGXCTC  986 GCAATTCTCCTGCCTCAGT/CCTCC
 42 CMYA5      C>G      5      CATCAGTAXTGCATGAGA  963 CATTTCAGGTTTAC/GTGCATGGAGGA
 41 NUDT17     C>A      3      GAGAGACAGCGTCXTCGC  938 GAGAGGACAAGCCGTCC/ATCGC
 40 TP53       C>T      5      CTCGTCATGCXGCATGCA  917 CCTCCGGTTCATGCC/TGCCCATGCA
 39 EMID1      C>T      3      GCACTACTCAGXGAGTGC  893 GGCACCTACCTTCAGC/TGAGTGC
 38 TP53       C>A      5      ATGCTCGTCATGXCGCAT  871 ATGGGCCTCCGGTTCATGC/ACGCCCAT
 37 IGHV2      G>C      3      TGTGCTGTAXTATATCAT  845 TGTGCTGTAG/CTATTTATCAT
 36 CTNNB1     A>G      5      ATCATCTGTGCACTXCAC  825 AATCCATTCTGGTGCCACTA/GCCAC
 35 SOGA1      G>A      3      TGCTGTCXCAGCTCTGCA  801 TGCTGTCG/ACAGCTCCTGCA
 34 EBF1       C>T      5      AGTCGCACTCGTCGTXCA  782 AGTCGCACCTCCCGTCGTC/TCA
 33 MFSD11     C>T      3      TAGCTXATAGCTCTGAGT  761 TAGCTC/TATAGCTCTGAGT
 32 OR5H6      G>A      5      GTCTATGTCTCATCTGXA  743 GGTCTAATTGTTCTCATCTGG/AAAA
 31 KMT2D      C>G      3      TGTXCTGAGACATGCACT  719 TTGTC/GCTTGAAGAACATGCACTT
 30 CENPC      G>C      5      CTATCTGAGATGATCTXA  696 CTATTCTGAGATGATCCTG/CA
 29 NF1        G>A      3      GAXGACTGTGCTGACGAC  676 GAAG/AGACTGTTGCTGACGAC
 28 EGFR       C>T      5      CACGTGCAGCTCATCAXG  656 CCACCGTGCAGCTCATCAC/TG
 27 GML        G>A      3      GXGACTACAGTGAGATGC  636 GG/AGACTTACAGTTTGAGATGCC
 26 HDAC9      C>T      5      ACACGCAGCACAGCTXAG  614 ACACGGCAGCACCAGGCTC/TAG
 25 TM7SF3     T>C      3      AXGCTGTATCAGCACTCT  593 AT/CGCCTGTAATCCCAGCACTCT
 24 FGF7       A>G      5      CTGAGCAGAGATCXCTGA  571 CTGAGGCAGGAGAATCA/GCTTGAA
 23 IKBKB      C>T      3      CXGAGATGTCTGAGGATG  548 CCC/TGAGATGTCCCTGAGGGGATG
 22 TP53       G>A      5      TGTGAGATGCTCXGTCAT  525 TGGTGAGGATGGGCCTCCG/AGTTCAT
 21 MAN2A1     G>A      3      TGXCTGAATATATAGTAT  500 TGG/ACTGGAAAATAATATAGGTAT
 20 TP53       C>T      5      TGAGATGCTCXGTCATGC  477 TGAGGATGGGCCTCC/TGGTTCATGCC
 19 PRSS27     A>G      3      CTCXTGTCTCAGCTGCTG  452 CCTCA/GTGTCCTCAGGCCTGGCTGGG
 18 SNRPN      T>C      5      CAGAGTGTXAGCATATGA  427 CCAAGAGGTGGTT/CAAAGCCATATTGGA
 17 LPA        G>A      3      AGCTCXATACTCTGTCAT  400 AGCCTCG/AATAACTCTGTCCAT
 16 EP300      C>T      5      GCTAGTXCTATGAGTATG  379 GCTAGTC/TCTATGGGAGTAAATGG
 15 ADSSL1     A>G      3      GCGTCGCXTGTGGAGAGC  356 GGCGTCGGCA/GTGGTGGGGAGGAGC
 14 HRNR       G>C      5      GAGAXTAGCTGACAGACA  332 GAAGAG/CTAGCCTGAACCAGACA
 13 CLDN18     C>T      3      CTCTGTGTCXGAGAGAGC  310 CTCCTGTGTCC/TGAGAGAGC
 12 TP53       C>A      5      ATGXCTCGTCATGCGCAT  291 ATGGGC/ACTCCGGTTCATGCCGCCCAT
 11 IGHV2      G>C      3      GATGTGCTGTAXTATATC  265 GATGTGCTGTAG/CTATTTATC
 10 RAF1       C>G      5      ATXTGGAGCATATCTCGC  245 ATC/GTGGGGAGGCATATCCTCGGC
  9 MRPS10     G>C      3      CATCACGTGTAGTXAACT  222 CATCAACGTGTAGGTTTG/CAAAACT
  8 CMYA5      C>G      5      AXTGCATGAGAGCACAGA  198 AC/GTGCATGGAGGAGCCACAAGA
  7 RAF1       T>C      3      ACGCAGCATCAGTAXTCA  176 ACGCAGCATCAGTAT/CTCCAA
  6 EFCAB2     A>G      5      GXAGTGCAGTGCGTGATC  156 GA/GAGTGCAGTGGCGTGATC
  5 CREB5      C>A      3      ACAGCATGCAGAGATXAC  137 AACAGCCATGCAGAAAGAATC/AAC
  4 NALCN      G>T      5      GTXATCATGTCTAGTGAC  114 GTTTG/TATCCATGTCTTAGTGACC
  3 ATM        C>T      3      ACACTCTCGCACGAGCXG   91 ACACTTCTCGCAAACGAGCC/TG
  2 CDC25C     T>A      5      CTCXGCTCACTGTGATAT   70 CTTCT/AGCTCACCTGTTTGGGAATAT
  1 CTNNB1     T>C      3      TGCACTACACAGCTCTXC   45 TGCCACTACCACAGCTCCTT/CC
  0 BRAF       C>G      5      CTGTXCATGATCAGATCA   24 CTGTTC/GCAAATGATCCAGATCCAA